ID: 1142018839_1142018846

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1142018839 1142018846
Species Human (GRCh38) Human (GRCh38)
Location 16:87767184-87767206 16:87767210-87767232
Sequence CCTTCCACCTTCCCATTTAAAAT CCAGACACTGTTAGGTACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 423} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!