ID: 1142027831_1142027839

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142027831 1142027839
Species Human (GRCh38) Human (GRCh38)
Location 16:87823986-87824008 16:87824019-87824041
Sequence CCTTCTTAGAGCAAGTGAATTAG AAGGCTGCCCAGAATGGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!