ID: 1142029919_1142029932

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1142029919 1142029932
Species Human (GRCh38) Human (GRCh38)
Location 16:87833359-87833381 16:87833403-87833425
Sequence CCTGCAGGTCCACACCCGGGCCA CTGTTCACAGCAGGCAGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 175} {0: 1, 1: 0, 2: 1, 3: 42, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!