ID: 1142029924_1142029934

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1142029924 1142029934
Species Human (GRCh38) Human (GRCh38)
Location 16:87833379-87833401 16:87833407-87833429
Sequence CCACCACCTGGACACATGCCTGG TCACAGCAGGCAGGGCCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 333} {0: 1, 1: 0, 2: 0, 3: 22, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!