ID: 1142038341_1142038352

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142038341 1142038352
Species Human (GRCh38) Human (GRCh38)
Location 16:87876563-87876585 16:87876603-87876625
Sequence CCTTCTAGCTTCTGTTTGAACAC CCGTTTCCTGAAGTTCGTATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!