|
Left Crispr |
Right Crispr |
| Crispr ID |
1142054587 |
1142054592 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:87985112-87985134
|
16:87985132-87985154
|
| Sequence |
CCGTGTGTGCTGGTGGCTGGCGC |
CGCTGGGTTAGGTGCTTTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 15, 4: 243} |
{0: 1, 1: 0, 2: 0, 3: 6, 4: 88} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|