ID: 1142056995_1142056998

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142056995 1142056998
Species Human (GRCh38) Human (GRCh38)
Location 16:88004196-88004218 16:88004238-88004260
Sequence CCCTGGGAGTGGACTGTGTTGAA CCATGAATGTTGTTGTTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 156} {0: 1, 1: 0, 2: 1, 3: 19, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!