ID: 1142060469_1142060474

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1142060469 1142060474
Species Human (GRCh38) Human (GRCh38)
Location 16:88026085-88026107 16:88026130-88026152
Sequence CCTGTTGAATACAGGGCATCTCT AGAGCTCTCCGTAGCGCAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 103} {0: 2, 1: 0, 2: 0, 3: 6, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!