ID: 1142066724_1142066728

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142066724 1142066728
Species Human (GRCh38) Human (GRCh38)
Location 16:88067217-88067239 16:88067231-88067253
Sequence CCGACTGGCTTGTGTGGCTGGTC TGGCTGGTCTCATGGGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116} {0: 1, 1: 0, 2: 1, 3: 35, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!