ID: 1142070249_1142070258

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142070249 1142070258
Species Human (GRCh38) Human (GRCh38)
Location 16:88087885-88087907 16:88087923-88087945
Sequence CCCCTGAGCACACCTGCCTAGCC AAGGGCTGACGAAATGCCTGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 196} {0: 1, 1: 1, 2: 0, 3: 10, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!