ID: 1142075537_1142075543

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142075537 1142075543
Species Human (GRCh38) Human (GRCh38)
Location 16:88115580-88115602 16:88115611-88115633
Sequence CCAGGGCCCTGTGTGTTCCTGGA CTCTAGTTCTGGAGACCAGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 48, 4: 346} {0: 2, 1: 0, 2: 1, 3: 23, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!