ID: 1142075555_1142075569

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1142075555 1142075569
Species Human (GRCh38) Human (GRCh38)
Location 16:88115662-88115684 16:88115715-88115737
Sequence CCCTCTGGAGGCTCTGGGCCCTT CCTTCCAGCCGTACTCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 39, 4: 293} {0: 1, 1: 5, 2: 2, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!