|
Left Crispr |
Right Crispr |
| Crispr ID |
1142075567 |
1142075579 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:88115697-88115719
|
16:88115749-88115771
|
| Sequence |
CCTCTGGGGGCTCTGGGTCCTTC |
CCTTCCAGCCATACTCCCTCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 3, 2: 6, 3: 34, 4: 321} |
{0: 1, 1: 5, 2: 7, 3: 21, 4: 216} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|