|
Left Crispr |
Right Crispr |
| Crispr ID |
1142075574 |
1142075579 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:88115723-88115745
|
16:88115749-88115771
|
| Sequence |
CCGTACTCCTTCTGGGGGCTCTG |
CCTTCCAGCCATACTCCCTCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 8, 3: 49, 4: 390} |
{0: 1, 1: 5, 2: 7, 3: 21, 4: 216} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|