ID: 1142085554_1142085561

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1142085554 1142085561
Species Human (GRCh38) Human (GRCh38)
Location 16:88178309-88178331 16:88178326-88178348
Sequence CCCTGACGACCGGGAGGAGAGGA AGAGGAAGGAGGGGAGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!