ID: 1142085554_1142085567

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1142085554 1142085567
Species Human (GRCh38) Human (GRCh38)
Location 16:88178309-88178331 16:88178356-88178378
Sequence CCCTGACGACCGGGAGGAGAGGA CGGGGCTGCAGGTTATGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104} {0: 2, 1: 0, 2: 0, 3: 12, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!