ID: 1142085560_1142085567

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142085560 1142085567
Species Human (GRCh38) Human (GRCh38)
Location 16:88178318-88178340 16:88178356-88178378
Sequence CCGGGAGGAGAGGAAGGAGGGGA CGGGGCTGCAGGTTATGAATGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 12, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!