ID: 1142094820_1142094825

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142094820 1142094825
Species Human (GRCh38) Human (GRCh38)
Location 16:88233736-88233758 16:88233757-88233779
Sequence CCTGGAGGCAGATCTGTTTCAGG GGACCCCGATGGGGACGTAGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 3, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!