ID: 1142123013_1142123024

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142123013 1142123024
Species Human (GRCh38) Human (GRCh38)
Location 16:88396538-88396560 16:88396569-88396591
Sequence CCGGGAGGAGACCCTCCTGAAGG ATGGAGACCCTCCTGAAGGGAGG
Strand - +
Off-target summary {0: 6, 1: 9, 2: 6, 3: 30, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!