|
Left Crispr |
Right Crispr |
| Crispr ID |
1142123013 |
1142123025 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:88396538-88396560
|
16:88396573-88396595
|
| Sequence |
CCGGGAGGAGACCCTCCTGAAGG |
AGACCCTCCTGAAGGGAGGCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 9, 2: 6, 3: 30, 4: 187} |
{0: 8, 1: 4, 2: 6, 3: 20, 4: 270} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|