ID: 1142123040_1142123058 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1142123040 | 1142123058 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16:88396619-88396641 | 16:88396658-88396680 |
| Sequence | CCGGGAGGAGACCCTCCTGAAGG | CCTCCTGAAGGGAGGCCGGGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 9, 1: 3, 2: 9, 3: 41, 4: 489} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||