ID: 1142131295_1142131301

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1142131295 1142131301
Species Human (GRCh38) Human (GRCh38)
Location 16:88432737-88432759 16:88432773-88432795
Sequence CCAGCTCACAAGAAAGTGAAGAC TTCCCTGTGAACAGAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 144} {0: 1, 1: 0, 2: 2, 3: 40, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!