ID: 1142133886_1142133900

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142133886 1142133900
Species Human (GRCh38) Human (GRCh38)
Location 16:88442946-88442968 16:88442977-88442999
Sequence CCCCGGCCGGCAGCATCCAGGGC CGGGTCAGCGGCTCTGGGACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!