ID: 1142133889_1142133898

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142133889 1142133898
Species Human (GRCh38) Human (GRCh38)
Location 16:88442952-88442974 16:88442972-88442994
Sequence CCGGCAGCATCCAGGGCACCCCA CCACTCGGGTCAGCGGCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!