ID: 1142136669_1142136682

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1142136669 1142136682
Species Human (GRCh38) Human (GRCh38)
Location 16:88454699-88454721 16:88454745-88454767
Sequence CCCACCCTATGCCAATAATAACT GACGCAGGTCTTCCTCCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210} {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!