ID: 1142137514_1142137525

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1142137514 1142137525
Species Human (GRCh38) Human (GRCh38)
Location 16:88458434-88458456 16:88458473-88458495
Sequence CCAGTGTGGCATCCAGCACCACT CAGTTGGAGAAGAAAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142} {0: 1, 1: 1, 2: 4, 3: 85, 4: 700}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!