ID: 1142138269_1142138274

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142138269 1142138274
Species Human (GRCh38) Human (GRCh38)
Location 16:88461279-88461301 16:88461295-88461317
Sequence CCTGGTGAGGACCAGGATGCTTG ATGCTTGCTGGGGAGTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 150} {0: 1, 1: 0, 2: 1, 3: 17, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!