ID: 1142144480_1142144489

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142144480 1142144489
Species Human (GRCh38) Human (GRCh38)
Location 16:88487197-88487219 16:88487239-88487261
Sequence CCAGGAGAGGTCAGCATGCTCAC AGAGAGACAGCAGCAGGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!