ID: 1142149981_1142149988

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142149981 1142149988
Species Human (GRCh38) Human (GRCh38)
Location 16:88508457-88508479 16:88508489-88508511
Sequence CCGTGGCTGCAGAGCAGGCCACA CACAGGCCTTGGGCTCCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 361} {0: 1, 1: 0, 2: 2, 3: 18, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!