ID: 1142149983_1142149997

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1142149983 1142149997
Species Human (GRCh38) Human (GRCh38)
Location 16:88508475-88508497 16:88508516-88508538
Sequence CCACAGAGTCCAACCACAGGCCT CCCTGGTCTCTCCTGGGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 249} {0: 1, 1: 1, 2: 4, 3: 68, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!