ID: 1142150195_1142150208

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1142150195 1142150208
Species Human (GRCh38) Human (GRCh38)
Location 16:88509304-88509326 16:88509345-88509367
Sequence CCTATGGGAGCCACAGGGCGGGG CCGATTAGATAAGTGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227} {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!