ID: 1142152000_1142152007

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142152000 1142152007
Species Human (GRCh38) Human (GRCh38)
Location 16:88516777-88516799 16:88516795-88516817
Sequence CCAGTTTTTCTTCTCTCTTTGTA TTGTAGAAGGAGAAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 171, 4: 3377} {0: 1, 1: 0, 2: 4, 3: 71, 4: 856}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!