ID: 1142167797_1142167804

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1142167797 1142167804
Species Human (GRCh38) Human (GRCh38)
Location 16:88602142-88602164 16:88602164-88602186
Sequence CCTACCTGTGCCCGCTGCAGGCA AGGGCCTCACCTGGAACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 243} {0: 1, 1: 1, 2: 3, 3: 25, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!