ID: 1142167797_1142167807

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142167797 1142167807
Species Human (GRCh38) Human (GRCh38)
Location 16:88602142-88602164 16:88602173-88602195
Sequence CCTACCTGTGCCCGCTGCAGGCA CCTGGAACAGCTGGCAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 243} {0: 1, 1: 0, 2: 2, 3: 30, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!