ID: 1142184019_1142184028

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1142184019 1142184028
Species Human (GRCh38) Human (GRCh38)
Location 16:88685977-88685999 16:88686007-88686029
Sequence CCAGGAAGATGACTCCAGGGTGC TGGGGCTGTAGTGGTTGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!