ID: 1142187002_1142187015

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142187002 1142187015
Species Human (GRCh38) Human (GRCh38)
Location 16:88699375-88699397 16:88699408-88699430
Sequence CCCGGCCTGCGCCCTCCTCCTGC TGAGCTGTCCCTACCCCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 102, 4: 1032} {0: 1, 1: 0, 2: 1, 3: 17, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!