ID: 1142187008_1142187015

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1142187008 1142187015
Species Human (GRCh38) Human (GRCh38)
Location 16:88699393-88699415 16:88699408-88699430
Sequence CCTGCTCCCCACAGCTGAGCTGT TGAGCTGTCCCTACCCCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 336} {0: 1, 1: 0, 2: 1, 3: 17, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!