ID: 1142189194_1142189196

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142189194 1142189196
Species Human (GRCh38) Human (GRCh38)
Location 16:88709811-88709833 16:88709827-88709849
Sequence CCTGGATGTGAAGATGCTGCTTT CTGCTTTTAAAGATGGAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 221} {0: 1, 1: 0, 2: 3, 3: 52, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!