ID: 1142190456_1142190466

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1142190456 1142190466
Species Human (GRCh38) Human (GRCh38)
Location 16:88714939-88714961 16:88714967-88714989
Sequence CCACCTGTCCTGGGCCGGGCTTG GCGGGAAGGCCGTCACCTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 258} {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!