ID: 1142190469_1142190478

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1142190469 1142190478
Species Human (GRCh38) Human (GRCh38)
Location 16:88714976-88714998 16:88715013-88715035
Sequence CCGTCACCTCGTGGGTGGCTTGA GTTTCTTGGCCCCTCGACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110} {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!