ID: 1142194483_1142194496

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142194483 1142194496
Species Human (GRCh38) Human (GRCh38)
Location 16:88733149-88733171 16:88733192-88733214
Sequence CCCCCAGGGGAGAGTCCTCCATC ACTGAGGCAGCTGCCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155} {0: 1, 1: 0, 2: 6, 3: 40, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!