ID: 1142201270_1142201286

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142201270 1142201286
Species Human (GRCh38) Human (GRCh38)
Location 16:88762200-88762222 16:88762242-88762264
Sequence CCTCCCGGCCCACCCAGAGCTCA GCTGAAGAAAGGGCCCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 391} {0: 1, 1: 0, 2: 1, 3: 14, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!