ID: 1142201984_1142201991

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142201984 1142201991
Species Human (GRCh38) Human (GRCh38)
Location 16:88765452-88765474 16:88765472-88765494
Sequence CCCTCCCCTCTCTGTGCCTTGAG GAGTTCCCAGTAAGTGAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!