ID: 1142204499_1142204510

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1142204499 1142204510
Species Human (GRCh38) Human (GRCh38)
Location 16:88776492-88776514 16:88776520-88776542
Sequence CCGGGGCCCAGCTTCCCTTGGAG CCACTAGCTGCCCCAGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 22, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!