ID: 1142209871_1142209878

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142209871 1142209878
Species Human (GRCh38) Human (GRCh38)
Location 16:88803925-88803947 16:88803946-88803968
Sequence CCCGCCAGGCCCGCACTCCGCGC GCCCCGGCCTCCGCTACCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 412} {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!