ID: 1142236951_1142236964

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1142236951 1142236964
Species Human (GRCh38) Human (GRCh38)
Location 16:88926916-88926938 16:88926967-88926989
Sequence CCTGCCCTCATCTCCTTTCTCTG TGGCGGCACACTCCTGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 121, 4: 1301} {0: 1, 1: 0, 2: 4, 3: 38, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!