ID: 1142238655_1142238659

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1142238655 1142238659
Species Human (GRCh38) Human (GRCh38)
Location 16:88935186-88935208 16:88935210-88935232
Sequence CCGGTCAGGGGCAGTCCTGGGTT TGATGTCTCTGGCGCAGGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!