ID: 1142240371_1142240383

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142240371 1142240383
Species Human (GRCh38) Human (GRCh38)
Location 16:88941914-88941936 16:88941934-88941956
Sequence CCCCCGCCCCCTGCCCCGCGCTC CTCGCCCCCAGCGCGGCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 267, 4: 2106} {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!