ID: 1142278670_1142278680

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1142278670 1142278680
Species Human (GRCh38) Human (GRCh38)
Location 16:89136720-89136742 16:89136759-89136781
Sequence CCCACCTGCCTCTGTGCCTACAG GATCACACAGCGGGCTTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 333} {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!