ID: 1142284779_1142284794 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1142284779 | 1142284794 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16:89167315-89167337 | 16:89167335-89167357 |
| Sequence | CCCCCCACCTTCCCAGTGCTCAG | CAGGGCCAGGGAAAGGGTGGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 9, 3: 122, 4: 1120} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||